Race, Environment, and Adaptation

1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar

radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress

negatively impacts the survival of humans by disturbing homeostasis. (5 pts)

I am choosing cold.  While it is completely possible to survive outside in moderate cold temperatures (I say as someone who has lived in a tent for an entire winter when temperatures dipped to single digits), extreme cold is a killer.  Hypothermia can come on suddenly when someone is not prepared for it (so can hyperthermia, which I know as someone born and raised in the desert).  When encountering extreme cold, the human body loses heat rapidly.  The skin will grow cold and white as the capillary constriction begins to conserve heat.  This is followed by shaking to attempt to warm up the body through movement.  When the shaking stops, numbness and frostbite have already begun in the peripheral and appendicular anatomy.  When the shaking stop, it gets really scary.  Numbness, pain, and loss of consciousness will follow (and directly in line behind those is coma and death).  Once when the temperature dropped really rapidly and I was not dressed for it (and miles from home) my entire body just ached and numbness and temporary neuropathy set in.  My hands didn’t feel numb they just stopped working and I’d randomly start dropping things.  My feet hurt.  I eventually took a taxi because I couldn’t actually control my body well enough to walk three blocks to the train station and that was scary.

Cold kills.  The body’s normal temperature of 98.6 (ish) is given away into the environment that is significantly colder.  The body’s systems slow and stop. The muscles contract in an attempt to heat up.

These facts are in some instances used by doctors to slow down medical processes in order to slow down the body processes during things like surgery.

2. Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation

from each of the different types of adaptations listed above (short term, facultative,

developmental and cultural). Include images of the adaptations. (5 pts each/ 20 pts total)

We adapt by using layers of warm clothing (natural fibers such as wool and fur are among the warmest), including a few layers for air to add insulation helps.  We also adapt by using shelter, such as caves, huts, tents, houses and in these houses use heat sources.  In my tent I used an electric blanket and about 8 blankets to survive single digits during the coldest parts of winter.  Fire, heated stones, bed warmers, and sleeping communally are other less technologically based heating adaptations.  The body also adapts to tolerate a certain range of temperature better than others… I am not sure of the physiological explanation but I know that for both my brother and I who grew up in the desert and then went to college outside of California (he in Colorado and I in Chicago), we both started out having a hard time with the cold (though he worse than me), and then by the end, the cold was no big deal but summers in California were brutal.  I am also really light skinned.  Light skin is an additional adaptation for living in colder climates where there are long periods with little sun.  The lower levels of melanin allow the body to absorb more vitamin D from the sun more quickly (or so they tell me).  It is less adapted for warmer sunny climates (like the bloody desert I live in now) where the skin is prone to burning due to radiation from the sun.

3. What are the benefits of studying human variation from this perspective across environmental

clines? Can information from explorations like this be useful to help us in any way? Offer one

example of how this information can be used in a productive way. (5 pts)

The benefit of studying variation in this way is to see how different environmental factors effect human behavior, development, and physiology.  The more we know the more we can use this knowledge.  One example is the induction of hypothermia to slow down body processes to help the body survive in situations where there are low levels of blood flow such as myocardial infarction or stroke in order to lower blood pressure and heart rate and slow down the clock so that doctors can intervene.

4. How would you use race to understand the variation of the adaptations you listed in #2? Explain

why the study of environmental influences on adaptations is a better way to understand human

variation than by the use of race. (10 pts)

Environmental influences on adaptations make the differences make sense and remove the biological determinism from the equation.  The philosophy of biological determinism has allowed people to have an excuse for blatant bias such as racism (and still happens with bias based on heterosexism as well).  But when one says, well, some humans adapted to living at climates close to the equator by developing dark skin that would protect them from burning in constant exposure to the sun, whereas in colder climates where there as significantly less sun for parts of the year to allow them to absorb more Vitamin D from exposure to the sun (it makes me wonder if there is any greater level of SAD with people with darker skin who live in more wintery climates).  It takes the value based judgments out of the equation when one says that these differences are due to adaptation to the environment instead of the curse of Cain or some other values based statement.

Language Experiment

This is going up late, I apologize.  Time got away from me today.

I chose to do the experiment with a friend who knows me very well.  Jonathan is my assistant director of the music group I read, as well as a good friend.  We did the experiment while walking around when he was working as a janitor on Saturday Night (this is something we do every week, walk and talk).  He's a tolerant guy and I knew he'd probably get a kick out of the experiment.

Part 1: No words, all non-verbal communication.
This was far easier than part two. It wasn't easy, and he definitely did NOT understand me all of the time, but I found that asking questions made the conversation keep going (since he could talk and I couldn't).  I did have to resort to a few interpretive dance moves (and borrowed one from the Village People) I also found that the more complex the idea (such as trying to say something was longer, or trying to ask if the hours at the new job were better, or trying to comment on someone losing a bra, "don't you NEED that?") were much more complex than simple yes, no, why, maybe, stupid.  I also told him he sucked when he said something sarcastic (I pointed at him and made a sucking sound) at which point he wasn't talking anymore because he was laughing too hard.  I did occasionally have to tap, or slap my hand so he'd look at me.  He was working, so I did have to get his attention.  I know that he and I have had partial conversations with kids in the room (as I said, we lead a music group together) not using words (or only using very large ones).  What did surprise me was that he did understand me quite a lot (on somethings that were surprising) and on others that seemed simple he was totally confused.  Though, trying to pantomime "don't you need that" in discussion of a bra was sort of... well... awkward.

Jonathan's overall language didn't change, though he did find my inability to always relate my ideas genuinely entertaining.  I should mention, he's kind of a geek.

My roommates in art school were both English Second Language students (and graduate students) so I am familiar with the issues that sometimes occur in trying to share complex ideas across language barriers.  It's hard to understand inflection in a language that is not your first, especially when you are struggling to understand meaning.  What was interesting was that both of my South Korean roommates were fine talking to me in person but had legitimate difficulty understanding English over the phone or if there was any kind of heavy accent (such as a heavy southern accent, Bostonian accent, or even an English accent on TV).  Being able to hear in person made it easier, and some body language was different but gestures did help in being able to understand each other

Part 2: No inflection or body language, words only.
I found this all but impossible.  It was exceptionally difficult.  My first coping mechanism was to keep my questions and answers very very short (why. Yes. No. and. Stupid.) but failed frequently during this part of the conversation.  I found that I HEARD how much vocal inflection and variation of pitch there is when I speak, and even, to an extent, when I write.  I kept failing and getting frustrated and Jonathan noted (we are both musicians, though he is a more trained and accomplished instrumental musician than I am) that when you are a musical person you hear tones and when you are a particularly energetic and animated person (as I am.  Thank you ADHD... it makes me a great teacher), inflection just comes naturally.  I can say a single word a dozen different ways and have a dozen different meanings.  As I said, I found this very frustrating.  What I eventually resorted to was something that came musically.  I picked a pitched and talked at a measured single pitch, slowly and deliberately on that single pitch.  Monotone speech does not come even slightly naturally, and I am naturally animated with lots of vocal inflection and body language.  I know that I speak more without my words than I do with my extensive and expansive vocabulary. The resorting to using a single pitch at a measured consistent rhythm worked pretty well but took a lot of concentration and sounded boring as crap.  And Jonathan watching me get the constipated look on my face having to work so hard to NOT be animated found it very entertaining.

There are, obviously, people who cannot read body language and meaning.  Those who are sight impaired would not be able to read body language, and those who are hearing impaired have a wholly different system for reading inflection (which is almost entirely physical inflection and really fascinating to watch).  But those who are most significantly effected by this are those with autism spectrum disorder who lack the ability to read other people's emotional states.  An interesting detail is that I, someone who has what could be termed as an exaggerated sense of inflection and animation, find myself to have a great affinity with individuals (adults and children) with autism spectrum disorders and Aspergers. I have known an worked with nearly a dozen different individuals in this range in the last three or four years and find that somehow I bond quite easily with kids who have autism.  I intuitively read them very well and I do not have trouble getting them to hear me or communicate with me.  I don't know if it is the fact that my body language and inflection are generally pretty exaggerated or if it's just that, as my friend who is a therapist frequently suggests, that kids know when you have a big heart because you've had troubles to, and it makes them want to trust you.

I can honestly not think of a way that this sort of thing would be to an advantage, though.  When reading body language would be at a disadvantage.  Possibly if you had some kind of anxiety disorder, and you misread people's body language as threatening then perhaps you could benefit by being able to do this less, but I cannot see an evolutionary advantage.  I do know, in my experience, that children who have come up in abusive homes sometimes get very skilled at reading tone of voice and body language as a survival technique, as one who can read when their abusive parent is becoming enraged is more easily capable of negotiating the dangerous situations.

I found both sides of the experiment interesting, but also found that I could communicate many things much easier without words than I could WITHOUT signs or inflection.

Piltdown Hoax

1) The Piltdown Hoax was based on falsified finds in Sussex county, England that were dubbed the "missing link" and evidence that the origin of man had occurred in England.  This was a deep reflection of the culture of the times, the leading up to World War 1 (or the Great War).  Deeply divisive nationalism sparked an interest in proving the superiority of one's own culture.  Interesting archaeological and paleontological finds had been made in France and in Germany while nothing really had been found in England.  England at this time was still basking in the glow of it's reputation as the British Empire, on which it was said that the sun never set.   The unquantifiable and yet unwavering belief in the superiority of one's own culture in addition to ambition, pride, and the desire to make something of oneself even at the cost of the truth could be considered driving forces here. 

In the early 20th century, a laborer digging in Sussex county, England near the village of Piltdown is said to have found a bone and turned it over to a gentleman in the community who had a reputation as a man of science, an amateur archaeologist with an interest in geology, Charles Dawson.  This was the first of the Piltdown "discoveries." Mr Dawson, in turn, took the discovery to noted local geologist, Sir Arthur Smith Woodward.  Another scientist who was brought into the project was the French priest Teilhard de Chardin. Together, these gentleman are assumed to be central to the hoax, though it's arguable whether they in fact perpetrated it or were victims of it, they are central to the happenings and supposed initial authentication of the find.  

In England the find was lauded as proof of British superiority and the war having started shortly thereafter, it was used as a morale booster.  Outside of Britain, it was considered questionable but due to the war, the questions were put aside.

Eventually scientific questioning became such that testing began, and eventually the authenticity of the find was falsified.  It was shown to be an elaborate hoax.  

2) The human frailties that were most obvious are those of pride, ambition, and nationalism above that of clear headed and objective scientific questioning.  The finds were clearly not as closely scrutinized as they could have been, as the video points out, the tool marks on the teeth would have been clear even under a magnifier glass.  It is evident that those who were involved in the find were either hoping to perpetuate the hoax or were so glad to find a point of nationalistic pride that they overlooked their own scientific scrutiny. Putting one's own ideology ahead of the evidence found through vigorous scientific inquiry (whether these ideologies are secular, theological, nationalistic, or personal) puts all findings in danger as it allows one to make compromises on the inquiry of truth by allowing one to be influenced by one's own beliefs. 

3)  Positive aspects of scientific inquiry including chemical dating processes (differing ones as they advanced), examination of the bones and their surface as well as the nature of the teeth and so forth for tooling marks, signs of legitimate age, and so forth.  Other scientific ideals that were put into play was the unbiased willingness to question the evidence at hand, even if it meant that what one hopes to be true will be disproved by such inquiry.  The willingness to demonstrate a truly open mind and to test what was thought to be known in order to legitimize or falsify it is central to scientific research and inquiry, and it was clearly used here, as was the courage to stand in the way of what was, at that point, years of tradition and assumption. 

4) I am not sure if it's possible to eliminate the human factor but I'm certainly convinced that one wouldn't want to.  It is central to human nature to be passionate and curious.  While our beliefs tend to influence our passions, the curiosity can temper our assumptions and we can set our minds to be, not necessarily objective, but to trust the evidence more than our own belief systems.  I had a teacher many years ago who liked to remind us that our opinions were only as valid as the evidence we had to back them up.  We couldn't just say "well this is what I believe!" without facing a "so what, where's your evidence?"  It was a really valuable lesson.

And I think these are the sort of lessons: those of social community, of questions, of curiosity, of rubbing up against each others ideals in order to sharpen our ideas, that is what makes the human element and contribution essentially priceless.  We are passionate.  We are curious. We do care.  We have to make sure, though, that our pride and our beliefs do not cloud our ability to test our own (and each other's) assumptions.

5) There is an essential difference between beliefs and science.  While our beliefs (and our passions) can guide our inquiry, it is important to remember that we do not have to prove every belief, but that we cannot toss out our beliefs as immutable fact without some sort of evidence to support them or framework within to attempt to falsify or confirm them.  We can believe something to be true and yet know that it's truth is not something we can question or evidence within a scientific framework of inquiry.  I honestly believe that to be okay.  I do believe in God, I do believe in creation.  I also find evolution to have an intense amount of evidence in it's favor and that it's the basis of a lot of our basic assumptions in the biological field.  I have no problem with this, even though to some the two may seem in congruent and contradictory.  My beliefs can influence what I inquire about, but they do not serve as pure and unadulterated evidence of their truth or lack thereof.

It is also essential to not get so caught up in our own pride as to ignore evidence to the contrary of things we believe to be truth.  If some amazing piece of evidence came out tomorrow that negated the overwhelming evidence for divergence within the whiles of evolutionary change, would we have the courage of our convictions about it's evidentiary nature to present it to the public, or would be too afraid to be scrutinized and questioned or laughed at for throwing a question at what is essentially something assumed to be true (and generally, rightfully so)?  Would we have too much pride and not enough courage to question or own assumptions?  Where would we be if Darwin hadn't had the courage to question the establishment?  

Comparative Primatology

Primates:

Lemurs
a)  Lemurs live only on the island of Madagascar and the Comoro Islands.  They once were found in old and new world, but now are extinct everywhere but this old world location off the coast of Africa.  Madagascar has 2 seasons "a hot, rainy season from November to April; and a cooler, dry season from May to October."  (http://www.wildmadagascar.org/overview/loc/19-climate.html#sthash.OioEXvqV.dpuf) It is tropical, hot and humid, and subject to cyclones.  Due to the origins of the Island and it's location before the landmass broke up, it shares certain kinds of plant and animal life with south america but not with the African Continent.  One example is the traveler's tree (www.wildmadagacar.org).  Madagascar was once totally covered with trees but is subject to deforestation for plots to grow rice on.  The trees are an important part of the Lemur's living environment since they are largely arboreal. 
b) True Lemurs are the size of a small to large house cat (http://anthro.palomar.edu/primate/prim_2.htm). Dwarf and Mouse Lemurs are the size of mice (like normal house mice, not the NYC subway dwelling rat.  That would be more like a true lemur).  The Indriidae are larger, some can measure nearly 4 feet from head to toe and can weigh around 20 pounds. Aye Aye's are smaller and less readily observed due to their nocturnal nature, as well as being relatively quiet and solitary. 
In terms of sexual dimorphism, females tend to dominate the males and tend to be the ones who take care of defending the group.  Females can also be quite aggressive towards others of lower social rank.  Males of higher rank tend to 'swagger' while lower ranked males tend to cower.  Their physical differences tend more to differences in color (for instance, in the ring tailed lemur, only males are all black), rather than substantial differences in size. 
c) The diversity of lemur species on the island of Madagascar has to do with the size and variation of the island, as well as it's isolation from the continent of Africa.  There are a wide number of Lemurs of different size. mostly arboreal some terrestrial, and mostly diurnal instead of nocturnal.  The little spur in the stink gland of the ring tailed lemur that helps them slash the bark of trees as well as the stink glands that they even use in battle (rubbing on their tails and then waving their tails around until the other guy gives up and leaves)... are examples of adaptation to the environment (the spur being a very arboreally handy trait).  
d)

Spider Monkey

a)Spider Monkeys are native to Central and northern South America, reaching as far north as the southern area of Mexico.  "The habitation of Spider monkeys primarily consists of the evergreen rainforests, semi deciduous and mangrove forests." http://www.angrydmonkey.com/guide-habitat-distribution.html  They live in trees (arboreal) and are awake during the day (diurnal). 

\b) Spider Monkeys can be fairly large growing up to 2 feet in size (http://www.srl.caltech.edu/personnel/krubal/rainforest/Edit560s6/www/animals/spidermonkeypage.html).  They have long arms and legs and a prehensile tail. They live in the upper layer of the trees and tend to find their food among the treetops.  They have hands like hooks and are acrobatic movers, some strides covering up to 40 feet (http://www.angrydmonkey.com/a-look-at-the-physical-characteristics.html).  There is not a great deal of sexual dimorphism (http://pin.primate.wisc.edu/factsheets/entry/black_spider_monkey), but they tend towards the same relative coloring and very similar sizes as well.  

c) Spider monkeys lack a thumb, but have a very long prehensile tail that they use for balance when walking on the ground as well as for stability when climbing and brachiating among the trees.  This lack of a thumb would seem to put them at a disadvantage, and yet these hook like hands make them excellent swingers and capable of swinging across great distances. 

this lack of a thumb would be an excellent adaptation for being able to stay in the top part of the trees, as would their extra long tails. 

d)

Baboon

a)Baboons are found in equatorial Africa in a more arid environment close to the savannah.  They live partly on the ground and partly in the trees, spending a more significant amount of their hunting time on the ground. 

They also lack a prehensile tail which definitely influences their interaction with their environment as well as choosing to spend most of their time on the ground. 

b)Baboons are 20-34 inches in height and their weight can vary widely from 30 to over 80 pounds.  One factor is the very obvious sexually dimorphic characteristics.  There are size as well as fur differences between the sexes in baboons.  In some baboons even the bones of their face are different (http://www.ncbi.nlm.nih.gov/pubmed/2021194).  Males are noticably larger, and if the species is colorful, the male is more colorful, more fluffy and more showy to gain the attention and sexual selection of the female. 

c) Their non-prehensile tail as well as physical strength and quadrapedal stride have definitely adapted to a mostly terrestrial lifestyle. 

Gibbon: 

a)Gibbons live in Forrest areas of southern Asia.  They are arboreal and, just the opposite of the aforementioned baboon, they rarely touch down from the trees.  Gibbons brachiate and can move through the forest as fast as 35 miles per hour (http://animals.nationalgeographic.com/animals/mammals/gibbon/?source=A-to-Z) and can bridge gaps as wide as 50 feet.  

When the Gibbon decends to the ground, they walk on two feet with their arms up for balance.  They are the most bipedal of the non-human primates (http://animals.nationalgeographic.com/animals/mammals/gibbon/?source=A-to-Z).  

b) They are sexually dimorphic, can vary somewhat in size and somewhat in coloring.  They are also said to be monogamous which is not a common primate trait (http://animals.nationalgeographic.com/animals/mammals/gibbon/?source=A-to-Z).  They seem to vary in color from male to female, as well.  

As with other primate species, their hooked hands and long arms make them excellent climbers and swingers, and are excellently adapted for living an arboreal life.  Their swinging capability also makes them able to travel safetly without leaving the trees to find food, keeping a relative distance from preditors that may be on the ground. 

Chimpanzee

Chimpanzee live in sub-Saharan Africa in the rain forests, woodlands, and grasslands.  They are well adapted to terrestrial or arboreal living, and can climb well. They are adapted to a wide variety of climates.  They are part of the ape class and do not, therefore have a prehensile tail. They have a generalized diet that includes seeds, fruit, plants, insects and sometimes meat.  The grow to 4 to 5.5 feet tall and 70 to 130 pounds in weight.  Males are generally larger than females, females have more obvious mammary tissue (specifically after having young).  Besides differences that are similar to human sexual differences, the differences between males and females are not too big.  

Their anatomy tends toward the fairly generalized which helps them to adapt to such varying areas and climates.  

Summary:
It does seem that environment does play a significant factor in the formation of some aspects of the primate physiology (such as arm length, hand shape, tail, etc... those with prehensile tails seem more likely to be arboreal whereas those without tend to be more terrestrial). In other senses, such as size there is somewhat of an effect (larger animals tend to be on the ground, smaller tend to be higher in the trees, though not exclusively), and sexual dimorphism tend to be less dramatically influenced by their need to adapt to their habitat.  There is not really an explaination in the habitat for the differences in the physical display among baboons, yet sexual selection and genetic heredity of desireable traits do seem to be excellent explainations for such things.  It also seems there is a wide variety among primates as to whether they are almost the same or very different between the genders within their own species.  This seems more of a speciated adaptation than one related to climate or living conditions. 

Analogy and Homology

Homologous Traits:
a) The forelimb of the human and the common house cat are the homologous traits I will examine.  Each limb has a humerus, radius, ulna structure, carpals and digit bones.  The skin and muscles vary but the bone structure is remarkably similar.
b) While there are five digits in both the human forelimb (arm) and the cat's forelimb (front paw), the cat's mammalian paw does not have an opposable thumb, but instead has five digits that function as a foot/paw due to the cat's quadrupedal nature. the digits on a cat's paw are also made up of three bones, where the human hand has four in the digit (though part of this bone in the human hand is also found in the palm distal to the carpals).  The structure of the human hand is adapted for grasping, pinching, grabbing, and has evolved from other primates with similar needs to grasp and be dexterous (to stay in a tree, be able to pick up our food, and so forth).  A cat's paw does not have the same grasping dexterity, but is much more strongly adapted for walking on four limbs and maintaining balance and fluid movement.  A cat's claws, an additional difference, would be the structure that would take the place of the grasping function in a primate hand, being able to claw into a tree to prevent falling and aid in climbing, whereas the primate (human or other primate) hand being able to grasp the limb would be advantageous for a climbing species of primate and the finer dexterity would be selected for as the species evolved into greater tool usage and manual dexterity.
c)the common ancestor would be a long ago diverged mammalian species with placental birth. Past that, I'm not sure because I find reading the Claudal structures really confusing.
d.

2. Analogous traits:

a) The human and alligator forelimb would be examples of analogous structures.  Humans being primates with their grasping reflex and Alligators with their quadrupedal forelimb structure are what I will consider. 

b) similarly to the overlap between the human arm and the cat's paw, the human forelimb is similar in osteological structure with a humerus, radius, ulna, carpal, metacarpal arrangement and similarly to the cat's paw, the alligator has five digits on the end of it's forelimb but again having claws rather than nails (which are a primate trait) as well as having a flat walking forefoot rather than a grasping dexterous hand. There is also a tougher skin and a webbing on the alligator's forelimb that is not there on the sensitive forelimb of the human species.  The alligator's webbing also makes them more evolved to paddling in water and walking on four limbs.
c) Darwin has stated that all beings have common ancestry if you look far enough back, yet one would have to go back far enough to the split between reptile and mammal species to see the common ancestry between alligator and human species.  They are obviously very different, it takes little observation of this to make that conclusion (even the vast difference in their skull, dentition, and skin type, as well as their method of ambulating).  Yet, where they would converge would be the species before the reptilian/mammalian split.  This would be the best argument for why the structures are analogous and despite their striking similarities, not homologous.  One has to go back SO far in the evolutionary divergence that one cannot help but assume they evolved side by side on totally separate clades of the evolutionary tree.
d)

mRNA code

My mRNA code:

CTACCTTACTTGTCTGATCGGATTCACGGCTGTAGTTTCATCGGCGTA

The Influence of Thomas Malthus on the ideas of Charles Darwin

In considering the influences on Charles Darwin's development of his theory of natural selection, I choose to consider Thomas Robert Malthus.  

"In October 1838, that is, fifteen months after I had begun my systematic inquiry, I happened to read for amusement Malthus on Population, and being well prepared to appreciate the struggle for existence which everywhere goes on from long- continued observation of the habits of animals and plants, it at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The results of this would be the formation of a new species. Here, then I had at last got a theory by which to work". Charles Darwin, from his autobiography. (1876)

(As Quoted on http://www.ucmp.berkeley.edu/history/malthus.html )

Thomas Malthus was a 19th Century Economist who in his essay On the Principle of Population (1798) made the observation that the rate of population grew faster than the growth rate of the available resources.  It was an observation made along the way to another point (that there must me economic factors at work that prevented the complete collapse of the human population, and that those economic factors are worth studying), it was this observation that inspired both Charles Darwin and Alfred Russel Wallace, respectively. The principle was basically that there are limited resources (food, water, shelter and so forth) and that population, unchecked, will grow beyond the resources ability to support the population.  Darwin, and separately Wallace, then moved forward to say that there were specific traits that made certain animals that had them more likely to be able to secure resources than were those animals and species without those traits. The favored traits would then be more likely to reproduce and therefore to continue and influence the population of that species towards a change from a mix of traits towards a more homogeneous state of containing the favored trait.  It was Malthus' observation that raised the framework for evolution by natural selection. 

The points of Darwin's theory most clearly influenced by Malthus are absolutely the potentiality of exponential population growth, the obvious fact that there were limiting factors on this growth, and limited resources and the ability to gain these resources.  

It's also interesting to consider the other potential outcomes of Thomas Malthus' ideas, including the proponents of eugenics and proponents of population control.  It's frightening to consider that the absolute twisting of these ideas could lead to policies like the genocidal policies of Nazi Germany during WW2 as well as the one child policy in China.  Less horrific ideas that were given forth from the idea that population grows beyond the resources with which to support it would be that of the birth control (and subsequent abortion) movement.  Margaret Sanger would have been very much on the same page as Malthus in the belief that large families are not to the benefit of society (though I do not agree with Ms Sanger, who would have found it to her detriment if her parents had stopped having children sooner, since she felt the sting of being in a large family, but also was one of the youngest of the siblings). 

Beyond Mathus' influence over the development of the idea of natural selection (central to the theories about species that Darwin developed), but also had a secondary effect of finally spurring Darwin to publish his ideas when independent of himself, and through the reading of Thomas Malthus' work, Alfred Russel Wallace came to the same conclusion about natural selection (even calling it that) totally independent of Darwin.  And Alfred's confirmation pushed Darwin to publish, finally, two decades after the Beagle docked and he left her.  Malthus was most certainly one of the giants upon whose shoulders Darwin stood.

There seems little chance of Darwin (or Wallace) having arrived at the idea of evolution by natural selection without the foundational ideas of Thomas Malthus.  Thomas Malthus' ideas are so central (and so much of) the theory of natural selection, as to be integral.  Without the concept of population growth and limited resources, how does Darwin bridge the gap produced by inherited traits being favored and thus changing the population of a species over time, even to diverging into separate species over much time.

Some argue that the 20 year delay for Darwin in publishing his theory was due to his fear of the social and political ramifications of his theory because it defied the Christian Biblical belief, held as an immutable doctrine at the time when the church had a wide reaching influence in all areas of public life.  There was a very real potential for being black balled at the best, from social interactions or punished by the church or the government.  Yet, there is also much evidence that a significant factor in Darwin's long delay in publishing his theories had to do with his desire to gather as much evidence as possible, and have as solid a case in favor of his argument as possible, as to not seem premature, but also as to be able to refute arguments regarding his ideas of common ancestry as well as those of natural selection.  It may be that the power of the church and his discovery which flew in the face of what some believed the Bible to be saying caused Darwin's delays, but it is also quite likely that he was as conscientious and careful in his research as one would think, and chose to not be too quick to publish an idea that would throw the world on it's ear before he'd throughoughly investigated it's possibilities and provided as much evidence as possible

Resources:

http://www.ucmp.berkeley.edu/history/malthus.html

http://www.bbc.co.uk/history/historic_figures/malthus_thomas.shtml

An Introduction to Biological Evolution by Kenneth V. Kardong

Introduction to Physical Anthropology by Robert Jurmain et. al. 

http://home.uchicago.edu/~rjr6/articles/Why%20Darwin%20Delayed.pdf